DNA Sequencing Activity

 

Protein Sequences

Norm: Met Val His Leu Thr Pro Glu Glu Lys Ser Ala

Abby: Met Val His Leu Thr Pro Val Glue Lys Ser Ala

Bob: Met Val His Leu Thr Pro Glue Glue STOP Ser Ala

Carol: Met Val His Leu Thr Val Arg Arg Ser Leu Pro

Norm was the control for this activity. Abby, Bob and Carol had their DNA sequence compared to his to find mutations. The lower the percent, the lower the similarities, the higher the mutations.
In the end, they will all be having at least some risk of developing a disease.
Abby and Bob had one base change in their DNA structure. Abby's mutation is called a Point Mutation, this particular mutation changed the type of Protein that the Codon was, from Glu to Val. The Glu is an extremely positive protein and the change to Val makes it hydrophobic, a change like this can change the entire shape of the protein and have extreme effects to the person.
Bob's mutations was a Truncation Mutation. The protein changes from a Lys to Stop. This section of Protein is now 3 codons shorter. A Mutation like this can change a person and give them bad diseases.
Carol... she has issues. 7 of the 11 codons compared to Norm have mutations. The change occurs in codon 5, one of the bases is missing, essentially moving all the other bases one to the left. Carol will either have a lot of issues or be super lucky and be normal (ya right). I know the section of DNA this is, continue reading to find out for your own. ;)

These are the DNA sequences that we used for the patients. Blast the codes here for your own data.

Norm: ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC

Abby: ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCC

Bob: ATGGTGCACCTGACTCCTGAGGAGTAGTCTGCC

Carol: ATGGTGCACCTGACCCTGAGGAGAAGTCTGCCC